On Friday November 24, 2017 around 5 pm EST portions of Xenbase may be intermittently available.

Click on this message to dismiss it.
Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xtr-miR-34a
Mature Sequence: UGGCAGUGUCUUAGCUGGUUGUU
Full Sequence:
CUGUGAGUGU UUCUUUGGCA GUGUCUUAGC UGGUUGUUGU GGCACGUUAU AGAAGUAGCA AUCAGCAAAU AUACUGCCCU AGAAGUUCUG
Mirbase: MI0004816
In Situ Images:

NF Stage 11

NF Stage 15

NF Stage 29

NF Stage 40

NF Stage 45

Cited Literature:
p53 and microRNA-34 are suppressors of canonical Wnt signaling.
Kim NH et al. 2011

My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556