Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xtr-miR-34a
Mature Sequence: UGGCAGUGUCUUAGCUGGUUGUU
Full Sequence:
CUGUGAGUGU UUCUUUGGCA GUGUCUUAGC UGGUUGUUGU GGCACGUUAU AGAAGUAGCA AUCAGCAAAU AUACUGCCCU AGAAGUUCUG
Mirbase: MI0004816
In Situ Images:

NF Stage 11

NF Stage 15

NF Stage 29

NF Stage 40

NF Stage 45

Cited Literature:
p53 and microRNA-34 are suppressors of canonical Wnt signaling.
Kim NH et al. 2011

My Xenbase: [ Log-in / Register ]
version: [4.7.1]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556