On Friday November 24, 2017 around 5 pm EST portions of Xenbase may be intermittently available.

Click on this message to dismiss it.
Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xtr-miR-34b
Mature Sequence: CAGGCAGUGUAGUUAGCUGAUUGU
Full Sequence:
Mirbase:
In Situ Images:

NF Stage 20

NF Stage 43

NF Stage 45

NF Stage 9

Cited Literature:
The miR-30 miRNA family regulates Xenopus pronephros development and targets the transcription factor Xlim1/Lhx1.
Agrawal R et al. 2009
p53 and microRNA-34 are suppressors of canonical Wnt signaling.
Kim NH et al. 2011
Xenopus microRNA genes are predominantly located within introns and are differentially expressed in adult frog tissues via post-transcriptional regulation.
Tang GQ et al. 2008

My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556