On Friday November 24, 2017 around 5 pm EST portions of Xenbase may be intermittently available.

Click on this message to dismiss it.
Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xtr-miR-367
Mature Sequence: AAUUGCACUGUAGCAAUGGUGA
Full Sequence:
UUACUGUUGC CUAUGUGCAA ACUCUGUGCU AUAUUGUCUA GAAUUGCACU GUAGCAAUGG
Mirbase: MI0004880
In Situ Images:

NF Stage 17

NF Stage 18

NF Stage 38

Cited Literature:
Stage-specific expression of microRNAs during Xenopus development.
Watanabe T et al. 2005

My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556