On Friday November 24, 2017 around 5 pm EST portions of Xenbase may be intermittently available.

Click on this message to dismiss it.
Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xtr-miR-449
Mature Sequence: AGGCAGUGUAAUGUUAGCUGGU
Full Sequence:
Mirbase:
In Situ Images:

NF Stage 10

NF Stage 10

NF Stage 18

NF Stage 26

NF Stage 40

NF Stage 40

Cited Literature:
MicroRNA-449 in cell fate determination.
Lizé M et al. 2011
Posttranscriptional activation of gene expression in Xenopus laevis oocytes by microRNA-protein complexes (microRNPs).
Mortensen RD et al. 2011
Control of vertebrate multiciliogenesis by miR-449 through direct repression of the Delta/Notch pathway.
Marcet B et al. 2011

My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556