On Friday November 24, 2017 around 5 pm EST portions of Xenbase may be intermittently available.

Click on this message to dismiss it.
Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xtr-miR-96
Mature Sequence: UUUGGCACUAGCACAUUUUUGCU
Full Sequence:
GGCCUGCUUU GGCACUAGCA CAUUUUUGCU UUUGUACAUA UACUUUGAGC AAUUAUGUGU AGUGCCAAUA
Mirbase: MI0004902
In Situ Images:

NF Stage 28

NF Stage 33

NF Stage 33

NF Stage 34

NF Stage 34

NF Stage 36

NF Stage 36

NF Stage 36

NF Stage 42

NF Stage 42

NF Stage 42

Cited Literature:
MicroRNAs in kidney development: lessons from the frog.
Wessely O et al. 2010
Xenopus microRNA genes are predominantly located within introns and are differentially expressed in adult frog tissues via post-transcriptional regulation.
Tang GQ et al. 2008
The miR-30 miRNA family regulates Xenopus pronephros development and targets the transcription factor Xlim1/Lhx1.
Agrawal R et al. 2009
FMR1/FXR1 and the miRNA pathway are required for eye and neural crest development.
Gessert S et al. 2010

My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556