|
|
| community | gene expression | genomics | genetics | atlas/movies/fate | cell biology |
| literature | methods | events | magazine | ||
| indexes | genes by name | genes by site | antibodies by name | Abs by site | search |
p63: sensorial epidermis and neural crest. To view the restriction to the sensorial layer of the epidermis view the confocal section stained with 4A4.
This page contains previously published text and images. Copyright © to all such materials belongs to Elsevier (2001).
Click on images to view enlargements (6K to 7K, < 2 seconds).
| Cloned by: | Original description: | ||
| Peter Vize | Lu P, Barad M, Vize PD. Xenopus p63 expression in early ectoderm and neurectoderm. Mech Dev. 2001 Apr;102(1-2):275-8. | ||
| Images submitted by: | Sequence | ||
| Peter Vize | Genbank AF314148 | ||
| Probe available from: | Other papers by: | ||
| Peter Vize | Peter Vize | ||
| In situ probe details: Xp63 cDNA in bluescript (Harland st28 derived) | Other papers on: | ||
| plasmid name: | antisense RE cut: | antisense transcription: | Xenopus p63 |
| pXp63 | NotI | T7 | |
| mRNA generation | RT-PCR primers, 224bp | ||
| plasmid name: | sense RE cut: | sense transcription: | + 5' TTGTCCGAATCATGAGCTGAG 3' |
| - 5' AATTCATCCCTCCAACACAGC 3' | |||
| antidody | subtype | Available from | Reference |
| 4A4 | IgG | Oncogene Sciences | Yang A, Kaghad M, Wang Y, Gillett E, Fleming MD, Dotsch V, Andrews NC, Caput D, McKeon F. p63, a p53 homolog at 3q27-29, encodes multiple products with transactivating, death-inducing, and dominant-negative activities. Mol Cell. 1998 Sep;2(3):305-16. |
| community | gene expression | genomics | genetics | atlas/movies/fate | cell biology |
| literature | methods | events | magazine | ||
| indexes | genes by name | genes by site | antibodies by name | Abs by site | search |
| contact the site administrator |
| credit/copright information information |