Xenbase: a Xenopus web resource

community gene expression genomics genetics atlas/movies/fate cell biology
literature methods events magazine    
indexes genes by name genes by site antibodies by name Abs by site search

p63: sensorial epidermis and neural crest. To view the restriction to the sensorial layer of the epidermis view the confocal section stained with 4A4.

This page contains previously published text and images. Copyright © to all such materials belongs to Elsevier (2001).

Click on images to view enlargements (6K to 7K, < 2 seconds).

mRNA in situ hybridization (Xp63) protein immunohistochemistry (4A4; anti-p63)
   
stage 17 stage 17, dorsal     stage 17 anterior stage 17, dorsal
the crescent of expression at the anterior-most end of the neural plate probably corresponds to the stomodeal-hypophyseal anlage. Within the epidermis staining is very even with the exception of an arc ventral to the presumptive hindbrain region of the neural plate which is devoid of Xp63 RNA. This region overlies the future branchial arches     Wholemount immunohistochemistry with antibody 4A4 (Yang et al. 1998) detects a nuclear protein whose distribution is very similar to that of Xp63 mRNA (see left)
   
stage 20 - 21 anterior stage 20 - 21 dorsal.     stage 19 stage 19 dorsal
expression in some of the forming cranial neural crest, in addition to continued expression in the stomodeal-hypophyseal anlage and in most of the epidermis        
   
stage 24 anterior stage 24 dorsal     stage 23-24 anterior stage 23 - 24 dorsal
expression observed in some of the forming cranial neural crest, in addition to continued expression in the stomodeal-hypophyseal anlage and in most of the epidermis. Within the cranial crest expression of Xp63 is observed in the mandibular and branchial crest, but is clearly absent from the hyoid crest.     4A4 immunoreactivity remains particularly high in majority of the epidermis, but consistent with the distribution of Xp63 RNA, is never expressed in the branchial placode ectoderm
   
red indicates expression in crest drived fin, stage 31+ stage 34 lateral. expression in branchial arches and tail fin     stage 31 anterior stage 28 lateral
   
stage 24 stage 30 stage 35-36 stage 38
As the lens begins to form from the deeper layer of sensorial ectoderm (Nieuwkoop and Faber, 1994) Xp63 expression in this layer is extinguished. Concomitant with the internalization of the lens, expression of Xp63 returns except for a small patch directly above the lens. By stage 38 even this small patch has reacquired Xp63 expression. Xp63 protein is also absent from the other forming ectodermal placodes such as the dorso-lateral and olfactory placodes.

 

 

Cloned by: Original description:
Peter Vize Lu P, Barad M, Vize PD. Xenopus p63 expression in early ectoderm and neurectoderm. Mech Dev. 2001 Apr;102(1-2):275-8.
Images submitted by: Sequence
Peter Vize Genbank AF314148
Probe available from: Other papers by:
Peter Vize Peter Vize
In situ probe details: Xp63 cDNA in bluescript (Harland st28 derived) Other papers on:
plasmid name: antisense RE cut: antisense transcription: Xenopus p63
pXp63 NotI T7  
mRNA generation RT-PCR primers, 224bp
plasmid name: sense RE cut: sense transcription: + 5' TTGTCCGAATCATGAGCTGAG 3'
      - 5' AATTCATCCCTCCAACACAGC 3'
antidody subtype Available from Reference
4A4 IgG Oncogene Sciences Yang A, Kaghad M, Wang Y, Gillett E, Fleming MD, Dotsch V, Andrews NC, Caput D, McKeon F. p63, a p53 homolog at 3q27-29, encodes multiple products with transactivating, death-inducing, and dominant-negative activities. Mol Cell. 1998 Sep;2(3):305-16.

 

community gene expression genomics genetics atlas/movies/fate cell biology
literature methods events magazine    
indexes genes by name genes by site antibodies by name Abs by site search

contact the site administrator
credit/copright information information