Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Images Attributions Wiki Source

Antibody Name: Pum1 Ab1

Common Name: Pumilio

Synonyms: XPum NN

Gene: pum1
XAO: oocyte

Clone Type: Polyclonal

Clone Number
Isotype IgG
Host Organism mouse
Xenopus Reactivity tropicalis, laevis
Non-Xenopus Reactivity
Description: Generated by Yamashita Lab
Name xPum
Type polypeptide
Post Translational Modifications None
Source Organism frog
Description AA coded between AAGGATCCATGAGCGTTGCATGTGTCTTG and AAACTCGAGTGCATACTGTTGCTGTTGTGC on the N-terminus of Xenopus Pumilio
Reported Usage
western blot
First: Involvement of Xenopus Pumilio in the translational regulation that is specific to cyclin B1 mRNA during oocyte maturation., Mech Dev 2003  
Most recent:
View All Papers