|
XB-ANTIBODY-14586629
Antibody Name:
Pum1 Ab2
Common Name: Pumilio RRID: Synonyms: xPum NC
Source: |
|
Antibody | |
Clone Number | |
Purification | |
Isotype | IgG |
Host Organism | mouse |
Xenopus Reactivity | tropicalis, laevis |
Non-Xenopus Reactivity | |
Description: | generated by Yamashita Lab |
Immunogen | |
Name | xPum |
Type | polypeptide |
Post Translational Modifications | None |
Source Organism | frog |
Description | AA coded between AAGGATCCGCCGCGCATCAGCAACACATA and AAACTCGAGAGAGGGCATGACATCTGACATon the N-terminus of Xenopus Pumilio |
Sequence | |
Reported Usage | |
western blot | |
Publications | |
First: |
Involvement of Xenopus Pumilio in the translational regulation that is specific to cyclin B1 mRNA during oocyte maturation., Mech Dev 2003 |
Most recent: | |
View All Papers |