Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249104

Morpholino Name: abce1 MO1
Synonyms: ABCE1 splice
mRNA Target: abce1

Morpholino Type: Splice Blocking()
Sequence:
5' AAGATTGCACCTATTCAGGAAAGGA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' TCCTTTCCTGAATAGGTGCAATCTT 3' ||||||||||||||||||||||||| 3' AGGAAAGGACTTATCCACGTTAGAA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold99286:4671727-4671751 25/25 Antisense target abce1.S
tropicalis 7.1 scaffold_1554:1925-1949 21/25 unknown
Publications
First: The essential vertebrate ABCE1 protein interacts with eukaryotic initiation factors. [J Biol Chem 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556