Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249105

Morpholino Name: abce1 MO2
Synonyms: ABCE1 atg
mRNA Target: abce1

Morpholino Type: Translation Blocking(ATG)
Sequence:
5' TGGTAAGTTTGTCTGCCATGTTGTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25 25/25
genomic

MO
5' GACAATATGGCAGACAAACTAACGA 3' ||||| |||||||||||||| || | 3' CTGTTGTACCGTCTGTTTGAATGGT 5' 5' GACAACATGGCAGACAAACTTACCA 3' ||||||||||||||||||||||||| 3' CTGTTGTACCGTCTGTTTGAATGGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold99286:4664140-4664164 25/25 Antisense target abce1.S
Scaffold190940:62332-62356 23/25 Antisense off-target Xelaev16024117m
Scaffold1187:977006-977030 21/25 unknown
Scaffold243:2923071-2923095 21/25 unknown
Scaffold33905:2034356-2034380 21/25 Sense off-target Xelaev16044729m
Scaffold40539:23107-23131 21/25 unknown
Scaffold80885:489388-489412 21/25 Sense off-target Xelaev16074372m
tropicalis 7.1 scaffold_1:165634741-165634765 22/25 Antisense target abce1
scaffold_3:43182726-43182750 21/25 Antisense off-target c12orf4
scaffold_3:7735846-7735870 21/25 unknown
Publications
First: The essential vertebrate ABCE1 protein interacts with eukaryotic initiation factors. [J Biol Chem 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556