Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249106

Morpholino Name: abi1 MO1
Synonyms: Abi1 MO
mRNA Target: abi1

Morpholino Type: Translation Blocking(5' UTR)
Sequence:
5' GCGCATCGCTTCCTCCTTGTACACT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' AGTGTAAAAGGAGGAAGCGATGCGC 3' |||||| |||||||||||||||||| 3' TCACATGTTCCTCCTTCGCTACGCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold52573:2384057-2384081 25/25 Antisense off-target Xelaev16060347m
Scaffold155082:3875429-3875453 23/25 Antisense off-target Xelaev16016239m
Scaffold1391:239874-239898 21/25 unknown
tropicalis 7.1 scaffold_6:120505116-120505140 24/25 Antisense target abi1
scaffold_3:100255399-100255423 21/25 Antisense off-target tubgcp6
Publications
First: Abelson interactor 1 (ABI1) and its interaction with Wiskott-Aldrich syndrome protein (wasp) are critical for proper eye formation in Xenopus embryos. [J Biol Chem 2013]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556