Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249108

Morpholino Name: abl2 MO1
Synonyms: Arg-MO2
mRNA Target: abl2

Morpholino Type: Translation Blocking(ATG)
Sequence:
5' CTGGCCCATCACCGGCCTTTAGTAA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' TTACTAAAGGCCGGGGATGGGCCAG 3' |||||||||||||| |||||||||| 3' AATGATTTCCGGCCACTACCCGGTC 5' 5' TTACTAAAGGCCGGTGATGGGCCAG 3' ||||||||||||||||||||||||| 3' AATGATTTCCGGCCACTACCCGGTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold206596:18-42 25/25 unknown
Scaffold53263:6125639-6125663 25/25 Antisense target abl2.L
Scaffold69443:8194554-8194578 25/25 Antisense off-target Xelaev16069000m
tropicalis 7.1 scaffold_4:109757561-109757585 24/25 Antisense target abl2
Publications
First: The cytoplasmic tyrosine kinase Arg regulates gastrulation via control of actin organization. [Dev Biol 2012]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556