Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249109

Morpholino Name: abl2 MO2
Synonyms: Arg-MO
mRNA Target: abl2

Morpholino Type: Translation Blocking(ATG)
Sequence:
5' GCCTACCTGCTGGCCCATCACCG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/23 23/23
genomic

MO
5' CGGGGATGGGCCAGCAGGTAGGC 3' ||| ||||||||||||||||||| 3' GCCACTACCCGGTCGTCCATCCG 5' 5' CGGTGATGGGCCAGCAGGTAGGC 3' ||||||||||||||||||||||| 3' GCCACTACCCGGTCGTCCATCCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold206596:9..31 23/23 unknown
Scaffold53263:6125630..6125652 23/23 Antisense target abl2.L
Scaffold69443:8194545..8194567 23/23 Antisense off-target Xelaev16069000m
Scaffold33231:321514..321536 19/23 Sense off-target Xelaev16044063m
Scaffold140858:674901..674923 19/23 unknown
Scaffold180433:65232..65254 19/23 Antisense off-target sox18.L
Scaffold44061:3466532..3466554 19/23 unknown
Scaffold48318:353589..353611 19/23 Sense off-target Xelaev16057707m
Scaffold61609:993388..993410 19/23 unknown
tropicalis 7.1 scaffold_4:109757552..109757574 22/23 Antisense target abl2
scaffold_1:22023439..22023461 20/23 unknown
scaffold_8:8372549..8372571 20/23 unknown
scaffold_2:102520493..102520515 19/23 unknown
scaffold_2:102521087..102521109 19/23 unknown
scaffold_4:24559020..24559042 19/23 unknown
scaffold_4:33745598..33745620 19/23 unknown
scaffold_5:108225986..108226008 19/23 unknown
scaffold_5:113481489..113481511 19/23 unknown
scaffold_5:79019736..79019758 19/23 unknown
scaffold_5b:7416667..7416689 19/23 unknown
scaffold_6:66378600..66378622 19/23 unknown
scaffold_6:77409044..77409066 19/23 unknown
scaffold_7:74159408..74159430 19/23 unknown
scaffold_77:337806..337828 19/23 unknown
scaffold_9:51911873..51911895 19/23 unknown
Publications
First: The cytoplasmic tyrosine kinase Arg regulates gastrulation via control of actin organization. [Dev Biol 2012]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.8.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556