Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249110

Morpholino Name: abr MO1
Synonyms: Abr MO
mRNA Target: abr

Morpholino Type: Translation Blocking(ATG)
Sequence:
5' TGTCTTGGTGGCTGACGGGTTCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold60518:1725054-1725078 25/25 Antisense off-target Xelaev16065567m
Scaffold36364:1928729-1928753 23/25 Antisense off-target Xelaev16047313m
Scaffold58049:3108239-3108263 21/25 Antisense off-target lrrk1.L
Publications
First: Control of local Rho GTPase crosstalk by Abr. [Curr Biol 2011]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556