Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249112

Morpholino Name: actb MO1
Synonyms: beta-actin AMO
mRNA Target: actb

Morpholino Type: translation blocking morpholino (ATG)
Sequence:
5' CAATATCGTCTTCCATTGTGATCTG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CAGATCACAATGGAAGACGATATTG 3' ||||||||||||||||||||||||| 3' GTCTAGTGTTACCTTCTGCTATAAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold120240:3194062..3194086 25/25 Antisense target actb.L
Scaffold26364:4934335..4934359 25/25 Antisense off-target Xelaev16035394m
tropicalis 7.1 scaffold_1:87617297..87617321 21/25 unknown
scaffold_4:21369689..21369713 21/25 Sense off-target cdc14a
Publications
First: Asymmetrical beta-actin mRNA translation in growth cones mediates attractive turning to netrin-1., Nat Neurosci 2006  
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.1


Major funding for Xenbase is provided by grant P41 HD064556