Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249123

Morpholino Name: admp MO1
Synonyms: ADMPMO, Admp MO, admp morpholino
mRNA Target: admp

Morpholino Type: translation blocking morpholino (ATG)
Sequence:
5' GGTCCATCTCATCAAGCTGCAGCTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' GAGCTGCAACTTGATGAGATGGACC 3' |||||||| |||||||||||||||| 3' CTCGACGTCGAACTACTCTACCTGG 5' 5' GAGCTGCAGCTTGATGAGATGGACC 3' ||||||||||||||||||||||||| 3' CTCGACGTCGAACTACTCTACCTGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold231526:1125413..1125437 25/25 Antisense target admp.S
Scaffold397002:126..150 25/25 unknown
Scaffold72621:238131..238155 25/25 Antisense off-target Xelaev16070238m
tropicalis 7.1 scaffold_1:122090596..122090620 24/25 Antisense target admp
Publications
First: Regulation of ADMP and BMP2/4/7 at opposite embryonic poles generates a self-regulating morphogenetic field., Cell 2005                        
Most recent: ADMP controls the size of Spemann''s organizer through a network of self-regulating expansion-restriction signals., BMC Biol 2018                  
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.2


Major funding for Xenbase is provided by grant P41 HD064556