Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249123

Morpholino Name: admp MO1
Synonyms: ADMPMO, Admp MO, admp morpholino
Target mRNA: admp

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' GGTCCATCTCATCAAGCTGCAGCTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 25/25
genomic

MO
5' GAGCTGCAACTTGATGAGATGGACC 3' |||||||| |||||||||||||||| 3' CTCGACGTCGAACTACTCTACCTGG 5' 5' GAGCTGCAGCTTGATGAGATGGACC 3' ||||||||||||||||||||||||| 3' CTCGACGTCGAACTACTCTACCTGG 5' 5' GAGCTGCAGCTTGATGAGATGGACC 3' ||||||||||||||||||||||||| 3' CTCGACGTCGAACTACTCTACCTGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1L:101980002..101980026 25/25 Antisense target admp.L
chr1S:90020982..90021006 25/25 Antisense target admp.S
Scaffold65810:126..150 25/25 unknown
tropicalis 10.0 Chr1:104483739..104483763 24/25 Antisense target admp
Publications
First: Regulation of ADMP and BMP2/4/7 at opposite embryonic poles generates a self-regulating morphogenetic field., Cell 2005                        
Most recent: ADMP controls the size of Spemann''s organizer through a network of self-regulating expansion-restriction signals., BMC Biol 2018                  
View All Papers