Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249124

Morpholino Name: admp2 MO1
Synonyms: ADMP2 A-MO
mRNA Target: admp2

Morpholino Type: translation blocking morpholino (ATG)
Sequence:
5' CACATCCTTGCTTCTTGGGTGAAAG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CTTTCACCCAAGAAGCAAGGATGTG 3' ||||||||||||||||||||||||| 3' GAAAGTGGGTTCTTCGTTCCTACAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr7L:56992680..56992704 25/25 Antisense target admp2.L
Publications
First: ADMP2 is essential for primitive blood and heart development in Xenopus., Dev Biol 2006                  
Most recent:
View All Papers