Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249125

Morpholino Name: adrb2 MO1
Synonyms: Adrbeta2-MO
mRNA Target: adrb2

Morpholino Type: translation blocking morpholino (ATG)
Sequence:
5' GGCTGGCGCTGACCGACCGTTCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ATGGAACGGTCGGTCAGCGCCAGCC 3' ||||||||||||||||||||||||| 3' TACCTTGCCAGCCAGTCGCGGTCGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold18892:3800054..3800078 25/25 Antisense target adrb2.L
tropicalis 7.1 scaffold_4:121383343..121383367 23/25 unknown
Publications
First: β-Adrenergic signaling promotes posteriorization in Xenopus early development., Dev Growth Differ 2013              
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556