Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249125

Morpholino Name: adrb2 MO1
Synonyms: Adrbeta2-MO
Target mRNA: adrb2

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' GGCTGGCGCTGACCGACCGTTCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ATGGAACGGTCGGTCAGCGCCAGCC 3' ||||||||||||||||||||||||| 3' TACCTTGCCAGCCAGTCGCGGTCGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:34228969..34228993 25/25 Antisense target adrb2.L
tropicalis 10.0 Chr4:136672277..136672301 23/25 Antisense off-target wdr6
Publications
First: β-Adrenergic signaling promotes posteriorization in Xenopus early development., Dev Growth Differ 2013              
Most recent:
View All Papers