Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249126

Morpholino Name: adrb2 MO2
Synonyms: Adrbeta2
Target mRNA: adrb2

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' GGGCTGGCGCTGACCGACCGTTCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 26/26
genomic

MO
5' ATGGAACGGTCGGTCAGCGCCAGCCC 3' |||||||||||||||||||||||||| 3' TACCTTGCCAGCCAGTCGCGGTCGGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:34228968..34228993 26/26 Antisense target adrb2.L
tropicalis 10.0 Chr4:136672277..136672302 23/26 Antisense off-target wdr6
Publications
First: β-Adrenergic signaling promotes posteriorization in Xenopus early development., Dev Growth Differ 2013              
Most recent:
View All Papers