Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249130

Morpholino Name: ahnak MO1
Synonyms: TNeu103f06, Xtnovel34
mRNA Target: ahnak

Morpholino Type: Splice Blocking()
Sequence:
5' TTCTTCTTCTTCTTTATCCATCTTG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' CTAGATGGATAAAGAAGAAGAAGAA 3' | ||||||||||||||||||||||| 3' GTTCTACCTATTTCTTCTTCTTCTT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold31469:1649281-1649305 24/25 unknown
Scaffold36134:109854-109878 23/25 unknown
Scaffold102262:2009712-2009736 22/25 Antisense off-target elp3.L
Scaffold102974:18976745-18976769 22/25 unknown
Scaffold143831:5319966-5319990 22/25 unknown
Scaffold151567:282072-282096 22/25 unknown
Scaffold195950:1700400-1700424 22/25 unknown
Scaffold218195:2441706-2441730 22/25 Antisense off-target Xelaev16028160m
Scaffold243:2994597-2994621 22/25 Sense off-target Xelaev16032318m
Scaffold2589:672645-672669 22/25 Antisense off-target Xelaev16034930m
Scaffold27891:1677024-1677048 22/25 Antisense off-target Xelaev16038231m
Scaffold36364:2546195-2546219 22/25 unknown
Scaffold382321:280-304 22/25 unknown
Scaffold44780:2451192-2451216 22/25 Antisense off-target Xelaev16054973m
Scaffold67052:9707-9731 22/25 unknown
Scaffold76530:561792-561816 22/25 Sense off-target ephb3.L
Scaffold78860:8173690-8173714 22/25 Sense off-target Xelaev16073481m
Scaffold82136:135591-135615 22/25 unknown
Scaffold9994:8158276-8158300 22/25 unknown
Scaffold104389:3-27 21/25 unknown
Scaffold11063:442079-442103 21/25 unknown
Scaffold11199:3250988-3251012 21/25 unknown
Scaffold11316:2297112-2297136 21/25 unknown
Scaffold1168:6997879-6997903 21/25 unknown
Scaffold120511:997510-997534 21/25 unknown
Scaffold120942:368000-368024 21/25 Antisense off-target Xelaev16005942m
Scaffold12462:1569569-1569593 21/25 Antisense off-target Xelaev16006708m
Scaffold12518:2270028-2270052 21/25 unknown
Scaffold126688:49-73 21/25 unknown
Scaffold129356:46-70 21/25 unknown
Scaffold134683:328973-328997 21/25 Sense off-target Xelaev16010059m
Scaffold13471:3593908-3593932 21/25 unknown
Scaffold134783:147-171 21/25 unknown
Scaffold135348:786786-786810 21/25 Sense off-target Xelaev16010565m
Scaffold137317:2201336-2201360 21/25 unknown
Scaffold150991:2923347-2923371 21/25 Sense off-target Xelaev16014962m
Scaffold158246:59-83 21/25 unknown
Scaffold163806:8023493-8023517 21/25 unknown
Scaffold167265:1760693-1760717 21/25 unknown
Scaffold167800:786131-786155 21/25 unknown
Scaffold169907:3796182-3796206 21/25 unknown
Scaffold179179:2522-2546 21/25 unknown
Scaffold18239:211549-211573 21/25 unknown
Scaffold188120:1819926-1819950 21/25 unknown
Scaffold197913:487061-487085 21/25 Antisense off-target sez6l2.S
Scaffold20641:993881-993905 21/25 unknown
Scaffold207208:699034-699058 21/25 Antisense off-target Xelaev16026748m
Scaffold218947:16-40 21/25 unknown
Scaffold22127:811391-811415 21/25 unknown
Scaffold226:953692-953716 21/25 Sense off-target Xelaev16029426m
Scaffold230550:1212065-1212089 21/25 unknown
Scaffold237412:1883419-1883443 21/25 unknown
Scaffold26819:1763072-1763096 21/25 unknown
Scaffold27036:2973553-2973577 21/25 unknown
Scaffold275250:113-137 21/25 unknown
Scaffold28181:807820-807844 21/25 unknown
Scaffold29017:723760-723784 21/25 unknown
Scaffold291413:129-153 21/25 unknown
Scaffold298574:1681304-1681328 21/25 Sense off-target Xelaev16040023m
Scaffold302805:471776-471800 21/25 Sense off-target Xelaev16040695m
Scaffold30711:1312057-1312081 21/25 unknown
Scaffold32212:5620159-5620183 21/25 unknown
Scaffold3467:2383610-2383634 21/25 unknown
Scaffold347078:295016-295040 21/25 unknown
Scaffold3490:242249-242273 21/25 unknown
Scaffold35361:4180861-4180885 21/25 Antisense off-target Xelaev16046412m
Scaffold36295:363210-363234 21/25 unknown
Scaffold3881:981395-981419 21/25 unknown
Scaffold43483:3052886-3052910 21/25 Antisense off-target Xelaev16053826m
Scaffold45174:489425-489449 21/25 unknown
Scaffold45834:168974-168998 21/25 unknown
Scaffold50694:2886399-2886423 21/25 unknown
Scaffold51452:2841765-2841789 21/25 unknown
Scaffold51988:4606758-4606782 21/25 unknown
Scaffold52170:602673-602697 21/25 unknown
Scaffold52573:6952116-6952140 21/25 Sense off-target pfkp.S
Scaffold53263:3302649-3302673 21/25 Sense off-target dio1.L
Scaffold61741:1654086-1654110 21/25 unknown
Scaffold62355:563655-563679 21/25 unknown
Scaffold62623:89-113 21/25 unknown
Scaffold71264:1910742-1910766 21/25 unknown
Scaffold74352:578371-578395 21/25 unknown
Scaffold75417:1375185-1375209 21/25 unknown
Scaffold7940:153885-153909 21/25 unknown
Scaffold8129:4396063-4396087 21/25 Sense off-target lcp1.S
Scaffold81941:831766-831790 21/25 Sense off-target Xelaev16074923m
Scaffold82029:63-87 21/25 unknown
Scaffold85380:1521987-1522011 21/25 Sense off-target Xelaev16076057m
Scaffold86352:53209-53233 21/25 Sense off-target Xelaev16076504m
Scaffold89475:2941407-2941431 21/25 unknown
Scaffold90072:805396-805420 21/25 Sense off-target atp6ap2.S
Scaffold9266:8875516-8875540 21/25 Antisense off-target mfge8.L
Scaffold93416:404920-404944 21/25 unknown
Scaffold93786:3593546-3593570 21/25 Antisense off-target ctr9.S
tropicalis 7.1 scaffold_1:19875628-19875652 24/25 unknown
scaffold_65:264368-264392 24/25 Antisense target ahnak
scaffold_1:95258036-95258060 22/25 Antisense off-target smc5
scaffold_164:195634-195658 22/25 unknown
scaffold_2:97450720-97450744 22/25 Antisense off-target myo16
scaffold_6:31650478-31650502 22/25 unknown
scaffold_7:57604933-57604957 22/25 unknown
scaffold_1:159059250-159059274 21/25 Antisense off-target spata5
scaffold_1:17168116-17168140 21/25 Sense off-target iqgap2
scaffold_1:38671469-38671493 21/25 unknown
scaffold_10:2078124-2078148 21/25 unknown
scaffold_10:32280910-32280934 21/25 unknown
scaffold_2:106560452-106560476 21/25 Antisense off-target lnx2
scaffold_2:115487135-115487159 21/25 Sense off-target loc642132
scaffold_2:59453618-59453642 21/25 unknown
scaffold_2:87051023-87051047 21/25 unknown
scaffold_24:275957-275981 21/25 unknown
scaffold_24:276244-276268 21/25 unknown
scaffold_31:262196-262220 21/25 unknown
scaffold_4:120138581-120138605 21/25 unknown
scaffold_4:132913492-132913516 21/25 Sense off-target magi1
scaffold_4:4990903-4990927 21/25 unknown
scaffold_4:5189886-5189910 21/25 unknown
scaffold_4:71783822-71783846 21/25 unknown
scaffold_5:49720500-49720524 21/25 unknown
scaffold_6:10911987-10912011 21/25 unknown
scaffold_6:140510169-140510193 21/25 Antisense off-target cry-dash
scaffold_7:18067767-18067791 21/25 Sense off-target LOC100486640
scaffold_7:76544515-76544539 21/25 unknown
scaffold_8:14517623-14517647 21/25 unknown
scaffold_8:55691113-55691137 21/25 Antisense off-target adad2
scaffold_875:7509-7533 21/25 Sense off-target slco1b3
scaffold_875:7695-7719 21/25 Sense off-target slco1b3
scaffold_9:23847653-23847677 21/25 Antisense off-target trpm2
scaffold_9:36930912-36930936 21/25 Sense off-target gk5
scaffold_9:6052829-6052853 21/25 unknown
scaffold_9:71208549-71208573 21/25 unknown
scaffold_9:98076507-98076531 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556