Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249137

Morpholino Name: aldh1a2 MO1
Synonyms: RALDH2 morpholino, XRALDH2 MO, XRALDH2-MO
mRNA Target: aldh1a2

Morpholino Type: translation blocking morpholino (ATG)
Sequence:
5' GCATCTCTATTTTACTGGAAGTCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' ATGACTTCCAGTAAAATCGAGATGC 3' ||||||||||||||||| ||||||| 3' TACTGAAGGTCATTTTATCTCTACG 5' 5' ATGACTTCCAGTAAAATAGAGATGC 3' ||||||||||||||||||||||||| 3' TACTGAAGGTCATTTTATCTCTACG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold351606:1189369..1189393 25/25 Antisense off-target Xelaev16046095m
Scaffold59883:1812248..1812272 25/25 Antisense target aldh1a2.L
Scaffold16807:8200752..8200776 21/25 unknown
Scaffold50464:1129540..1129564 21/25 Antisense off-target Xelaev16058483m
tropicalis 7.1 scaffold_9:58114310..58114334 24/25 Antisense target aldh1a2
scaffold_57:176929..176953 21/25 unknown
Publications
First: Retinol dehydrogenase 10 is a feedback regulator of retinoic acid signalling during axis formation and patterning of the central nervous system., Development 2009                  
Most recent: A Retinoic Acid-Hedgehog Cascade Coordinates Mesoderm-Inducing Signals and Endoderm Competence during Lung Specification., Cell Rep 2016                                                
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.13.0


Major funding for Xenbase is provided by grant P41 HD064556