Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249146

Morpholino Name: ap1m1 MO1
Synonyms: AP-1 mu1A, TNeu104l10, XtM1a
mRNA Target: ap1m1

Morpholino Type: Translation Blocking(5' UTR)
Sequence:
5' GCCGAAGATAGTCCTGCAAAGGCAA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 22/25
genomic

MO
5' TTGCCTTTGCAGGACTATCTTCGGC 3' ||||||||||||||||||||||||| 3' AACGGAAACGTCCTGATAGAAGCCG 5' 5' TTGCCTTCGAAGGGCTATCTTCGGC 3' ||||||| | ||| ||||||||||| 3' AACGGAAACGTCCTGATAGAAGCCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold160942:5459058-5459082 22/25 unknown
Scaffold54274:1073680-1073704 22/25 Antisense target ap1m1.S
tropicalis 7.1 scaffold_1:129428416-129428440 25/25 Antisense target ap1m1
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent: CVAK104 is a novel regulator of clathrin-mediated SNARE sorting. [Traffic 2007]
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556