Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249147

Morpholino Name: ap2m1 MO1
Synonyms: AP-2 mu, AP2m2
mRNA Target: ap2m1

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence:
5' GATCTTCACTCTCTCGCGGCTCCTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25
genomic

MO
5' GAGGAGCCGCGAGAGAGTGAAGGTA 3' |||||||||||||||||||||| | 3' CTCCTCGGCGCTCTCTCACTTCTAG 5'
Genomic Alignments Position Identity Strand Target mRNA
tropicalis 7.1 scaffold_5:10188846..10188870 23/25 Antisense target ap2m1
scaffold_963:5484..5508 23/25 unknown
Publications
First: CVAK104 is a novel regulator of clathrin-mediated SNARE sorting., Traffic 2007              
Most recent: Rspo3 binds syndecan 4 and induces Wnt/PCP signaling via clathrin-mediated endocytosis to promote morphogenesis., Dev Cell 2011        
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556