Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249166

Morpholino Name: arid3a MO1
Synonyms: dril1 MO
mRNA Target: arid3a

Morpholino Type: uncategorized morpholino
Sequence:
5' GGTGGGGCAGGCGAGCGGGCACAG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/24 23/24
genomic

MO
5' GTGTCCCCGCTCGCCTGCCCCACC 3' ||| ||||||||||||||||||| 3' GACACGGGCGAGCGGACGGGGTGG 5' 5' GTGTGCCCGCTCGCCTGCCCCACC 3' ||||||||||||||||||||||| 3' GACACGGGCGAGCGGACGGGGTGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold54274:3000033..3000056 23/24 Antisense target arid3a.S
Scaffold39437:1345671..1345694 22/24 Antisense off-target Xelaev16049980m
tropicalis 7.1 scaffold_1:126015296..126015319 22/24 Antisense target arid3a
scaffold_3:47793096..47793119 20/24 unknown
scaffold_370:54471..54494 20/24 Antisense off-target itpr2
Publications
First: The ARID domain protein dril1 is necessary for TGF(beta) signaling in Xenopus embryos., Dev Biol 2005                                
Most recent: Dual control of pcdh8l/PCNS expression and function in Xenopus laevis neural crest cells by adam13/33 via the transcription factors tfap2α and arid3a., Elife 2017                                        
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556