Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249176

Morpholino Name: atp4a MO1
Synonyms: ATP4aMO
mRNA Target: atp4a

Morpholino Type: uncategorized morpholino
Sequence:
5' GTCATATTGTTCCTTTTTCCCCATC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold157684:798581..798605 22/25 unknown
Scaffold10735:252..276 21/25 unknown
Scaffold1187:939713..939737 21/25 unknown
Scaffold13941:2412149..2412173 21/25 Antisense off-target Xelaev16012273m
Scaffold146311:501060..501084 21/25 unknown
Scaffold17836:2179343..2179367 21/25 unknown
Scaffold237598:3441999..3442023 21/25 Sense off-target Xelaev16031682m
Scaffold26819:1724871..1724895 21/25 unknown
Scaffold58049:1180865..1180889 21/25 unknown
Scaffold9994:1065689..1065713 21/25 Sense off-target socs1.L
tropicalis 7.1 scaffold_1:190777627..190777651 21/25 unknown
scaffold_1:32387808..32387832 21/25 unknown
scaffold_2:40194897..40194921 21/25 Sense off-target cblb
Publications
First: ATP4a is required for Wnt-dependent Foxj1 expression and leftward flow in Xenopus left-right development., Cell Rep 2012                                
Most recent: ATP4a is required for development and function of the Xenopus mucociliary epidermis - a potential model to study proton pump inhibitor-associated pneumonia., Dev Biol 2015                                
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556