Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249180

Morpholino Name: bambi MO1
Synonyms: Bambi MO
mRNA Target: bambi

Morpholino Type:
Sequence:
5' GAGATTCCACCATCCAGCCCAGCGT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 25/25
genomic

MO
5' AAGCTGGGCTGGATGGTGGGATCTC 3' | ||||||||||||||||| ||||| 3' TGCGACCCGACCTACCACCTTAGAG 5' 5' ACGCTGGGCTGGATGGTGGAATCTC 3' ||||||||||||||||||||||||| 3' TGCGACCCGACCTACCACCTTAGAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold17434:880857-880881 25/25 Antisense target bambi.L
Scaffold52573:3193432-3193456 23/25 Antisense off-target Xelaev16060360m
Scaffold125077:10880-10904 21/25 unknown
Scaffold146032:107322-107346 21/25 unknown
Scaffold170971:336-360 21/25 unknown
Scaffold282291:733-757 21/25 unknown
Scaffold284912:2209-2233 21/25 unknown
Scaffold307258:21398-21422 21/25 unknown
Scaffold9266:5920264-5920288 21/25 unknown
tropicalis 7.1 scaffold_6:121288150-121288174 23/25 Antisense target bambi
scaffold_42:333085-333109 21/25 unknown
Publications
First: Regulation of ADMP and BMP2/4/7 at opposite embryonic poles generates a self-regulating morphogenetic field. [Cell 2005]
Most recent: Negative feedback in the bone morphogenetic protein 4 (BMP4) synexpression group governs its dynamic signaling range and canalizes development. [Proc Natl Acad Sci U S A 2011]
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556