Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249180

Morpholino Name: bambi MO1
Synonyms: Bambi MO
Target mRNA: bambi

Morpholino Type: uncategorized morpholino
Sequence: 5' GAGATTCCACCATCCAGCCCAGCGT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25 23/25
genomic

MO
5' AAGCTGGGCTGGATGGTGGGATCTC 3' | ||||||||||||||||| ||||| 3' TGCGACCCGACCTACCACCTTAGAG 5' 5' ACGCTGGGCTGGATGGTGGAATCTC 3' ||||||||||||||||||||||||| 3' TGCGACCCGACCTACCACCTTAGAG 5' 5' ACGCGGGGCTGGATGGTGGCATCTC 3' |||| |||||||||||||| ||||| 3' TGCGACCCGACCTACCACCTTAGAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6L:20838466..20838490 25/25 Antisense target bambi.L
chr6S:17324117..17324141 23/25 Antisense target bambi.S
Scaffold41:1654907..1654931 21/25 Antisense off-target LOC108704598 [provisional:slc32a1]
Scaffold41:1659888..1659912 21/25 Antisense off-target LOC108704598 [provisional:slc32a1]
Scaffold145:14586..14610 21/25 unknown
Scaffold1552:2209..2233 21/25 unknown
Scaffold41:1596146..1596170 21/25 unknown
Scaffold41:1604594..1604618 21/25 unknown
Scaffold41:1618851..1618875 21/25 unknown
Scaffold41:1626134..1626158 21/25 unknown
Scaffold41:1643171..1643195 21/25 unknown
Scaffold42417:336..360 21/25 unknown
chr3L:97256615..97256639 21/25 unknown
tropicalis 10.0 Chr6:24154131..24154155 23/25 Antisense target bambi
Chr3:142058355..142058379 21/25 Sense off-target LOC100170611
Publications
First: Regulation of ADMP and BMP2/4/7 at opposite embryonic poles generates a self-regulating morphogenetic field., Cell 2005                        
Most recent: Negative feedback in the bone morphogenetic protein 4 (BMP4) synexpression group governs its dynamic signaling range and canalizes development., Proc Natl Acad Sci U S A 2011        
View All Papers