Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249181

Morpholino Name: bard1 MO1
Synonyms: xBARD1 AS#2
mRNA Target: bard1

Morpholino Type: uncategorized morpholino
Sequence:
5' CACTCCCGTTGATTAGACGTTCCGA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' TCGGAACGTCTAATCAACGGGAGTG 3' ||||||||||||||||||||||||| 3' AGCCTTGCAGATTAGTTGCCCTCAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold13787:3158609..3158633 25/25 Antisense target bard1.L
Publications
First: Functional communication between endogenous BRCA1 and its partner, BARD1, during Xenopus laevis development., Proc Natl Acad Sci U S A 2001                  
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556