Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249182

Morpholino Name: bard1 MO2
Synonyms: xBARD1 AS#1
mRNA Target: bard1

Morpholino Type:
Sequence:
5' CCTTAGCAGCATAATGAGGGGAGCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 21/25 25/25
genomic

MO
5' GTTTCCCCTCGGTATGCTGCTAAGG 3' | ||||||| ||||||||||||| 3' CCGAGGGGAGTAATACGACGATTCC 5' 5' GGCTCCCCTCATTATGCTGCTAAGG 3' ||||||||||||||||||||||||| 3' CCGAGGGGAGTAATACGACGATTCC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold13787:3158584-3158608 25/25 Antisense target bard1.L
Scaffold151039:1164636-1164660 21/25 unknown
Scaffold347078:373418-373442 21/25 Antisense off-target Xelaev16045657m
tropicalis 7.1 scaffold_79:45412-45436 21/25 Sense off-target akap8
scaffold_9:45898918-45898942 21/25 Antisense target bard1
scaffold_9:91099926-91099950 21/25 Sense off-target runx2
Publications
First: Functional communication between endogenous BRCA1 and its partner, BARD1, during Xenopus laevis development. [Proc Natl Acad Sci U S A 2001]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556