Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249184

Morpholino Name: barhl2 MO2
Synonyms: Xbarhl2ASI
mRNA Target: barhl2

Morpholino Type:
Sequence:
5' GATCCTTCCATGCTGCTTCCAGTTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25 23/25
genomic

MO
5' GACTGGGAAGCAGCATGGAAGGATC 3' || |||||||||||||||||||| 3' CTTGACCTTCGTCGTACCTTCCTAG 5' 5' GAATGGGAAGCAGCATGGAAGGATC 3' ||| |||||||||||||||||||| 3' CTTGACCTTCGTCGTACCTTCCTAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold47606:2098309-2098333 25/25 Antisense off-target Xelaev16057171m
Scaffold380348:426083-426107 23/25 Antisense target barhl2.S
Scaffold202026:192721-192745 21/25 unknown
Scaffold237412:431326-431350 21/25 Sense off-target Xelaev16031548m
Scaffold26819:2174559-2174583 21/25 unknown
Scaffold42281:644702-644726 21/25 unknown
Scaffold52352:815875-815899 21/25 Sense off-target Xelaev16059955m
Scaffold58878:4958770-4958794 21/25 unknown
Scaffold8355:263912-263936 21/25 unknown
Scaffold93416:1554926-1554950 21/25 unknown
tropicalis 7.1 scaffold_4:68572677-68572701 22/25 Antisense target barhl2
scaffold_6:89053644-89053668 22/25 Sense off-target ccdc127
scaffold_1:5818268-5818292 21/25 unknown
scaffold_3:88522658-88522682 21/25 Sense off-target zfc3h1
scaffold_6:92808677-92808701 21/25 Antisense off-target acad11
Publications
First: The pro-apoptotic activity of a vertebrate Bar-like homeobox gene plays a key role in patterning the Xenopus neural plate by limiting the number of chordin- and shh-expressing cells. [Development 2005]
Most recent: The conserved barH-like homeobox-2 gene barhl2 acts downstream of orthodentricle-2 and together with iroquois-3 in establishment of the caudal forebrain signaling center induced by Sonic Hedgehog. [Dev Biol 2014]
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556