Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249186

Morpholino Name: bcl6 MO1
Synonyms: BCL6 MO
mRNA Target: bcl6

Morpholino Type:
Sequence:
5' TTGAGTTTGAGATGCCATAGTGCCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' GGGCACTATGGCATCTCAAACTCTA 3' ||||||||||||||||||||||| | 3' CCCGTGATACCGTAGAGTTTGAGTT 5' 5' GGGCACTATGGCATCTCAAACTCAA 3' ||||||||||||||||||||||||| 3' CCCGTGATACCGTAGAGTTTGAGTT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold203280:951349-951373 25/25 Antisense target bcl6.L
Scaffold53349:378321-378345 25/25 Antisense off-target Xelaev16061250m
Scaffold343399:870951-870975 21/25 Antisense off-target Xelaev16044928m
tropicalis 7.1 scaffold_5:7029966-7029990 24/25 Antisense target bcl6
scaffold_10:15217915-15217939 21/25 unknown
Publications
First: BCL6 canalizes Notch-dependent transcription, excluding Mastermind-like1 from selected target genes during left-right patterning. [Dev Cell 2010]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556