Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249188

Morpholino Name: bcor MO2
Synonyms: xtBcor ATG2
mRNA Target: bcor

Morpholino Type:
Sequence:
5' GCCTCCCCCTTCTTATAAATCTGTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GACAGATTTATAAGAAGGGGGAGGC 3' ||||||||||||||||||||||||| 3' CTGTCTAAATATTCTTCCCCCTCCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold137317:2136170-2136194 24/25 Antisense off-target Xelaev16011257m
Scaffold78978:3048268-3048292 21/25 Sense off-target Xelaev16073601m
tropicalis 7.1 scaffold_2:54230075-54230099 25/25 Antisense target bcor
scaffold_2:56224032-56224056 21/25 Antisense off-target f5
Publications
First: Left-sided embryonic expression of the BCL-6 corepressor, BCOR, is required for vertebrate laterality determination. [Hum Mol Genet 2007]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556