Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249189

Morpholino Name: bdnf MO1
Synonyms: BDNF, BDNF MO, BDNF morpholino
mRNA Target: bdnf

Morpholino Type: uncategorized morpholino
Sequence:
5' CTCACCTGATGGAACTTATTTTAGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold47683:2513030..2513054 21/25 Sense off-target Xelaev16057374m
Scaffold68717:752186..752210 21/25 Antisense off-target Xelaev16068500m
tropicalis 7.1 scaffold_8:84233493..84233517 21/25 Sense off-target tyro3
Publications
First: Pro-BDNF-induced synaptic depression and retraction at developing neuromuscular synapses., J Cell Biol 2009                
Most recent: Activity-dependent transcription of BDNF enhances visual acuity during development., Neuron 2011  
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556