Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249190

Morpholino Name: bdnf MO2
Synonyms: bdnf
mRNA Target: bdnf

Morpholino Type: uncategorized morpholino
Sequence:
5' ATGGTCATCACTCTTCTCACCTGA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/24 24/24
genomic

MO
5' TCAGGTGAGAAGAGTGATGACCAT 3' |||||||||||||||||||||||| 3' AGTCCACTCTTCTCACTACTGGTA 5' 5' TCAGGTGAGAAGAGTGATGACCAT 3' |||||||||||||||||||||||| 3' AGTCCACTCTTCTCACTACTGGTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold241799:80..103 24/24 unknown
Scaffold51988:1571298..1571321 24/24 Antisense off-target Xelaev16059498m
Scaffold74352:5902921..5902944 24/24 Antisense target bdnf.S
Scaffold32657:3140547..3140570 20/24 unknown
Scaffold47683:276429..276452 20/24 Antisense off-target Xelaev16057331m
Scaffold53263:6756812..6756835 20/24 Sense off-target Xelaev16061195m
tropicalis 7.1 scaffold_4:19570485..19570508 24/24 Antisense target bdnf
scaffold_3:106498263..106498286 20/24 Sense off-target fam185a
scaffold_3:109892941..109892964 20/24 unknown
scaffold_3:47931417..47931440 20/24 Antisense off-target tbc1d9b
scaffold_3626:3832..3855 20/24 unknown
scaffold_414:64963..64986 20/24 unknown
Publications
First: BDNF promotes target innervation of Xenopus mandibular trigeminal axons in vivo., BMC Dev Biol 2007                    
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556