Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249191

Morpholino Name: bgn MO1
Synonyms: xBgn-Mo2
mRNA Target: bgn

Morpholino Type: uncategorized morpholino
Sequence:
5' CAATATACAAAGGTTCCTTCCAGGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 25/25
genomic

MO
5' GCCTGGAAGGAATCTTTGCATATTG 3' |||||||||||| ||||| |||||| 3' CGGACCTTCCTTGGAAACATATAAC 5' 5' GCCTGGAAGGAACCTTTGTATATTG 3' ||||||||||||||||||||||||| 3' CGGACCTTCCTTGGAAACATATAAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold159399:229521..229545 25/25 Antisense target bgn.S
Scaffold409945:4139..4163 25/25 unknown
Scaffold320982:4962..4986 24/25 unknown
Scaffold13523:4468877..4468901 21/25 unknown
tropicalis 7.1 scaffold_8:8314196..8314220 23/25 Antisense target bgn
Publications
First: Biglycan is a new extracellular component of the Chordin-BMP4 signaling pathway., EMBO J 2005  
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556