Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249193

Morpholino Name: bicc1 MO1
Synonyms: xBic-C- MO1, xBic-CMO1, xBicC MO1
mRNA Target: bicc1

Morpholino Type: uncategorized morpholino
Sequence:
5' TAGACTCGCACTGAGCCGCCATTCT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' AGAATGGCGGCTCAGTGCGAGTCTA 3' ||||||||||||||||||||||||| 3' TCTTACCGCCGAGTCACGCTCAGAT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold18192:3389679..3389703 25/25 Antisense target bicc1.S
Scaffold52916:193..217 21/25 unknown
Publications
First: Xenopus Bicaudal-C is required for the differentiation of the amphibian pronephros., Dev Biol 2007                    
Most recent: Bicaudal C, a novel regulator of Dvl signaling abutting RNA-processing bodies, controls cilia orientation and leftward flow., Development 2009    
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556