Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249196

Morpholino Name: bmp1 MO1
Synonyms: BMP1 MO
mRNA Target: bmp1

Morpholino Type: uncategorized morpholino
Sequence:
5' CAGCCTGTGGGATATCATTGTGTCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' GGACACAATGATATCCCACAGGCTG 3' ||||||||||||||||||||||||| 3' CCTGTGTTACTATAGGGTGTCCGAC 5' 5' GGACACAATGATATCCCACAGGCTG 3' ||||||||||||||||||||||||| 3' CCTGTGTTACTATAGGGTGTCCGAC 5' 5' GGACACAATGATATCCCACAGGCTG 3' ||||||||||||||||||||||||| 3' CCTGTGTTACTATAGGGTGTCCGAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold139741:724194..724218 25/25 Antisense target bmp1.L
Scaffold59267:54123..54147 25/25 Antisense target bmp1.S
Scaffold123964:232707..232731 21/25 Sense off-target Xelaev16006428m
tropicalis 7.1 scaffold_3:8137250..8137274 25/25 Antisense target bmp1
scaffold_3:75324984..75325008 22/25 Sense off-target dbn1
Publications
First: Robust stability of the embryonic axial pattern requires a secreted scaffold for chordin degradation., Cell 2008                    
Most recent: Generation of animal form by the Chordin/Tolloid/BMP gradient: 100¬†years after D''Arcy Thompson., Dev Growth Differ 2017              
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556