Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249197

Morpholino Name: bmp2 MO1
Synonyms: Bmp2, Bmp2-MO, bmp2 MO
mRNA Target: bmp2

Morpholino Type: uncategorized morpholino
Sequence:
5' GATCCCAGCGACCATTGTCAACCTG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' CAGGTTGACAATGGTCGCTGGGATC 3' ||||||||||||||||||||||||| 3' GTCCAACTGTTACCAGCGACCCTAG 5' 5' CAGGTTGACAATGGTCGCTGGGATC 3' ||||||||||||||||||||||||| 3' GTCCAACTGTTACCAGCGACCCTAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold102974:21190904..21190928 25/25 Antisense target bmp2.L
Scaffold27036:7847885..7847909 25/25 Antisense target bmp2.S
Publications
First: Default neural induction: neuralization of dissociated Xenopus cells is mediated by Ras/MAPK activation., Genes Dev 2005  
Most recent: BMP signalling controls the construction of vertebrate mucociliary epithelia., Development 2015                          
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.1


Major funding for Xenbase is provided by grant P41 HD064556