Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249198

Morpholino Name: bmp3 MO1
Synonyms: xBMP-3 MO
mRNA Target: bmp3

Morpholino Type: uncategorized morpholino
Sequence:
5' GAGCCAGGGGCGACACTCTGCCATC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 25/25
genomic

MO
5' AATGGCAGAGTGTCGCCCCTGGCTT 3' ||||||||||||||||||||||| 3' CTACCGTCTCACAGCGGGGACCGAG 5' 5' GATGGCAGAGTGTCGCCCCTGGCTC 3' ||||||||||||||||||||||||| 3' CTACCGTCTCACAGCGGGGACCGAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold5895:2925082..2925106 25/25 Antisense target bmp3.L
Scaffold56125:2740881..2740905 24/25 Antisense off-target Xelaev16062480m
tropicalis 7.1 scaffold_1:133317538..133317562 23/25 Antisense target bmp3
Publications
First: Coordination of BMP-3b and cerberus is required for head formation of Xenopus embryos., Dev Biol 2003                              
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.3


Major funding for Xenbase is provided by grant P41 HD064556