Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249199

Morpholino Name: bmp4 MO1
Synonyms: BMP4 MO, Bmp4, TNeu045c17, XtBMP4, bmp4-2ome
mRNA Target: bmp4

Morpholino Type:
Sequence:
5' CAGCATTCGGTTACCAGGAATCATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' CATGATTCCTGGTAACCGAATGCTG 3' ||||||||||||||||||||||||| 3' GTACTAAGGACCATTGGCTTACGAC 5' 5' CATGATTCCTGGTAACCGAATGCTG 3' ||||||||||||||||||||||||| 3' GTACTAAGGACCATTGGCTTACGAC 5' 5' CATGATTCCTGGTAACCGAATGCTG 3' ||||||||||||||||||||||||| 3' GTACTAAGGACCATTGGCTTACGAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold236382:809504-809528 25/25 Antisense target bmp4.S
Scaffold267922:3189059-3189083 25/25 Antisense target bmp4.L
tropicalis 7.1 scaffold_8:72118554-72118578 25/25 Antisense target bmp4
Publications
First: Default neural induction: neuralization of dissociated Xenopus cells is mediated by Ras/MAPK activation. [Genes Dev 2005]
Most recent: BMP signalling controls the construction of vertebrate mucociliary epithelia. [Development 2015]
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556