Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249200

Morpholino Name: bmp4 MO2
Synonyms: BMP-4MO2
mRNA Target: bmp4

Morpholino Type: uncategorized morpholino
Sequence:
5' ACATTCCATGATTCTTGACAGCCAA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 24/25 24/25
genomic

MO
5' TTGGCAGTCAAGAATCATGGACTGT 3' ||||| ||||||||||||||| ||| 3' AACCGACAGTTCTTAGTACCTTACA 5' 5' TTGGCTGTCAAGAATCATGGACTGT 3' ||||||||||||||||||||| ||| 3' AACCGACAGTTCTTAGTACCTTACA 5' 5' TTGGCTGTCAAGAATCATGGACTGT 3' ||||||||||||||||||||| ||| 3' AACCGACAGTTCTTAGTACCTTACA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold236382:809977..810001 24/25 Antisense target bmp4.S
Scaffold267922:3189788..3189812 24/25 Antisense target bmp4.L
Scaffold93452:355509..355533 21/25 Sense off-target Xelaev16079078m
tropicalis 7.1 scaffold_8:72119371..72119395 23/25 Antisense target bmp4
scaffold_4:33917393..33917417 21/25 unknown
Publications
First: The initiation of Hox gene expression in Xenopus laevis is controlled by Brachyury and BMP-4., Dev Biol 2004                    
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556