Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249200

Morpholino Name: bmp4 MO2
Synonyms: BMP-4MO2
Target mRNA: bmp4

Morpholino Type: uncategorized morpholino
Sequence: 5' ACATTCCATGATTCTTGACAGCCAA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 24/25 24/25
genomic

MO
5' TTGGCAGTCAAGAATCATGGACTGT 3' ||||| ||||||||||||||| ||| 3' AACCGACAGTTCTTAGTACCTTACA 5' 5' TTGGCTGTCAAGAATCATGGACTGT 3' ||||||||||||||||||||| ||| 3' AACCGACAGTTCTTAGTACCTTACA 5' 5' TTGGCTGTCAAGAATCATGGACTGT 3' ||||||||||||||||||||| ||| 3' AACCGACAGTTCTTAGTACCTTACA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8L:71227609..71227633 24/25 Antisense target bmp4.L
chr8S:13731623..13731647 24/25 Antisense target bmp4.S
chr8L:71227609..71227633 24/25 Sense off-target LOC108698759
chr5S:48196609..48196633 21/25 Sense off-target LOC108717414 [provisional:plg]
tropicalis 10.0 Chr8:94981769..94981793 23/25 Antisense target bmp4
Chr4:45345580..45345604 21/25 unknown
Publications
First: The initiation of Hox gene expression in Xenopus laevis is controlled by Brachyury and BMP-4., Dev Biol 2004                    
Most recent:
View All Papers