Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249201

Morpholino Name: bmp4 MO3
Synonyms: BMP-4MO1
mRNA Target: bmp4

Morpholino Type: uncategorized morpholino
Sequence:
5' TTGACAGAAAACAAGGCATAGAAAA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 23/25 24/25
genomic

MO
5' TTTTCTATGCCTTGTTTTCTGTCAG 3' |||||||||||||||||||||||| 3' AAAAGATACGGAACAAAAGACAGTT 5' 5' TTTTCTATGCCTTGTTTTGTGTCAG 3' |||||||||||||||||| ||||| 3' AAAAGATACGGAACAAAAGACAGTT 5' 5' TTTTCTATGCCTTGTTTTCTGTCAG 3' |||||||||||||||||||||||| 3' AAAAGATACGGAACAAAAGACAGTT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold236382:809952..809976 24/25 Antisense target bmp4.S
Scaffold267922:3189763..3189787 23/25 Antisense target bmp4.L
Scaffold138921:2177271..2177295 22/25 unknown
Scaffold161503:4297717..4297741 22/25 Antisense off-target Xelaev16017828m
Scaffold38656:1643798..1643822 22/25 unknown
Scaffold40789:44..68 22/25 unknown
Scaffold56125:4271077..4271101 22/25 unknown
Scaffold79772:2303163..2303187 22/25 unknown
Scaffold109418:2391570..2391594 21/25 unknown
Scaffold1168:3715701..3715725 21/25 unknown
Scaffold120240:3593498..3593522 21/25 Antisense off-target wipi2.L
Scaffold128772:25523..25547 21/25 unknown
Scaffold133047:312852..312876 21/25 Antisense off-target map7d1.L
Scaffold139752:18016..18040 21/25 unknown
Scaffold154130:311842..311866 21/25 unknown
Scaffold157968:1568359..1568383 21/25 Sense off-target Xelaev16016644m
Scaffold16001:724189..724213 21/25 unknown
Scaffold16863:918323..918347 21/25 Antisense off-target Xelaev16019774m
Scaffold18239:1508310..1508334 21/25 Antisense off-target Xelaev16022576m
Scaffold195048:283647..283671 21/25 Antisense off-target Xelaev16024684m
Scaffold200825:4839737..4839761 21/25 unknown
Scaffold208406:991..1015 21/25 unknown
Scaffold226:484965..484989 21/25 Antisense off-target Xelaev16029405m
Scaffold32657:955477..955501 21/25 unknown
Scaffold3286:312837..312861 21/25 Antisense off-target Xelaev16043712m
Scaffold36364:2742938..2742962 21/25 Sense off-target Xelaev16047345m
Scaffold40738:1353108..1353132 21/25 unknown
Scaffold409144:392165..392189 21/25 unknown
Scaffold409155:599..623 21/25 unknown
Scaffold41523:6141288..6141312 21/25 Antisense off-target itsn2.L
Scaffold46492:4880..4904 21/25 Sense off-target ndufs2.S
Scaffold47457:806313..806337 21/25 Antisense off-target Xelaev16056755m
Scaffold50694:1382087..1382111 21/25 Sense off-target Xelaev16058534m
Scaffold58878:5937585..5937609 21/25 Antisense off-target Xelaev16064315m
Scaffold71264:3840821..3840845 21/25 unknown
Scaffold89475:988213..988237 21/25 Sense off-target abhd12.S
Scaffold91366:815872..815896 21/25 unknown
Scaffold9994:12543796..12543820 21/25 unknown
tropicalis 7.1 scaffold_8:72119346..72119370 24/25 Antisense target bmp4
scaffold_3:83000499..83000523 22/25 unknown
scaffold_9:52010136..52010160 22/25 unknown
scaffold_1:24363096..24363120 21/25 unknown
scaffold_1:31037785..31037809 21/25 unknown
scaffold_2:15140756..15140780 21/25 unknown
scaffold_4:113274096..113274120 21/25 Antisense off-target fhod1
scaffold_6:103119427..103119451 21/25 Antisense off-target tax1bp1
scaffold_8:31244931..31244955 21/25 unknown
Publications
First: The initiation of Hox gene expression in Xenopus laevis is controlled by Brachyury and BMP-4., Dev Biol 2004                    
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556