Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249202

Morpholino Name: bmp4 MO4
Synonyms: BMP4 MO
mRNA Target: bmp4

Morpholino Type: uncategorized morpholino
Sequence:
5' CCAGGAATCATGGTGTCTTGACAGA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold42960:6637753..6637777 22/25 unknown
Scaffold87714:326413..326437 22/25 Antisense off-target fbxo9.L
Scaffold113759:132850..132874 21/25 Sense off-target gh2.S
Scaffold331151:21109..21133 21/25 Antisense off-target acer3.S
tropicalis 7.1 scaffold_2:51474124..51474148 22/25 Sense off-target cdkl5
scaffold_1:156288274..156288298 21/25 unknown
Publications
First: Twisted gastrulation is required for forebrain specification and cooperates with Chordin to inhibit BMP signaling during X. tropicalis gastrulation., Dev Biol 2006                                    
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556