Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249203

Morpholino Name: bmp7.2 MO1
Synonyms: Bmp7, Bmp7-MO, bmp7 MO
mRNA Target: bmp7.2

Morpholino Type: uncategorized morpholino
Sequence:
5' TTACTGTCAAAGCATTCATTTTGTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' GACAAAATGAATGCTTTGATAGTAA 3' ||||||||||||||||||| ||||| 3' CTGTTTTACTTACGAAACTGTCATT 5' 5' GACAAAATGAATGCTTTGACAGTAA 3' ||||||||||||||||||||||||| 3' CTGTTTTACTTACGAAACTGTCATT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold59883:2808282..2808306 25/25 Antisense target bmp7.2.L
Scaffold351606:422093..422117 24/25 Antisense off-target Xelaev16046072m
Scaffold202158:2560251..2560275 22/25 unknown
Scaffold15038:2846182..2846206 21/25 unknown
Scaffold202806:1008855..1008879 21/25 Sense off-target Xelaev16025799m
Scaffold203041:3595764..3595788 21/25 Antisense off-target Xelaev16025949m
Scaffold36401:1336189..1336213 21/25 unknown
Scaffold63404:1743372..1743396 21/25 Antisense off-target Xelaev16066792m
tropicalis 7.1 scaffold_9:57235208..57235232 24/25 Antisense target bmp7.2
scaffold_5:69263508..69263532 22/25 unknown
scaffold_6:41252946..41252970 22/25 Sense off-target mib1
scaffold_8:87335299..87335323 22/25 Antisense off-target znf106
scaffold_1:131501967..131501991 21/25 Antisense off-target fsd1
scaffold_5:101556473..101556497 21/25 unknown
Publications
First: Default neural induction: neuralization of dissociated Xenopus cells is mediated by Ras/MAPK activation., Genes Dev 2005  
Most recent: BMP signalling controls the construction of vertebrate mucociliary epithelia., Development 2015                          
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.3


Major funding for Xenbase is provided by grant P41 HD064556