Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249203

Morpholino Name: bmp7.2 MO1
Synonyms: Bmp7, Bmp7-MO, bmp7 MO
mRNA Target: bmp7.2

Morpholino Type: uncategorized morpholino
Sequence:
5' TTACTGTCAAAGCATTCATTTTGTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25 24/25
genomic

MO
5' GACAAAATGAATGCTTTGATAGTAA 3' ||||||||||||||||||| ||||| 3' CTGTTTTACTTACGAAACTGTCATT 5' 5' GACAAAATGAATGCTTTGACAGTAA 3' ||||||||||||||||||||||||| 3' CTGTTTTACTTACGAAACTGTCATT 5' 5' GACAAAATGAATGCTTTGATAGTAA 3' ||||||||||||||||||| ||||| 3' CTGTTTTACTTACGAAACTGTCATT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:88664517..88664541 25/25 Antisense target bmp7.2.L
chr3S:54023955..54023979 24/25 Antisense target bmp7.2.S
chr6L:94009651..94009675 21/25 Sense off-target LOC108719153
chr6S:111034705..111034729 21/25 Antisense off-target angpt1.S
chr8S:3605956..3605980 21/25 Antisense off-target znf106.S
chr4L:50281226..50281250 22/25 unknown
chr3S:33284967..33284991 21/25 unknown
chr4L:68938337..68938361 21/25 unknown
tropicalis 10.0 Chr3:98670489..98670513 24/25 Antisense target bmp7.2
Chr6:108639386..108639410 22/25 Sense off-target mib1
Chr8:108094649..108094673 22/25 Antisense off-target znf106
Chr1:93976663..93976687 21/25 Antisense off-target fsd1
Chr5:25362277..25362301 21/25 Sense off-target LOC105947449
Chr5:56091494..56091518 22/25 unknown
Publications
First: Default neural induction: neuralization of dissociated Xenopus cells is mediated by Ras/MAPK activation., Genes Dev 2005  
Most recent: BMP signalling controls the construction of vertebrate mucociliary epithelia., Development 2015                          
View All Papers