Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249204

Morpholino Name: bmp7.2 MO2
Synonyms: BMP7 MO, BMP7-MO
mRNA Target: bmp7.2

Morpholino Type: uncategorized morpholino
Sequence:
5' CTGTCAAAGCATTCATTTTGTCAAA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25 23/25
genomic

MO
5' TTTGACAAAATGAATGCTTTGATAG 3' |||||||||||||||||||||| || 3' AAACTGTTTTACTTACGAAACTGTC 5' 5' TTTGACAAAATGAATGCTTTGACAG 3' ||||||||||||||||||||||||| 3' AAACTGTTTTACTTACGAAACTGTC 5' 5' TCTGACAAAATGAATGCTTTGATAG 3' | |||||||||||||||||||| || 3' AAACTGTTTTACTTACGAAACTGTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:88664520..88664544 25/25 Antisense target bmp7.2.L
chr3S:54023952..54023976 23/25 Antisense target bmp7.2.S
chr6L:83889814..83889838 21/25 Antisense off-target serpinb10.L
chr2S:70430151..70430175 22/25 unknown
chr4L:50281229..50281253 22/25 unknown
chr5L:105611304..105611328 21/25 unknown
chr6L:64110573..64110597 21/25 unknown
chr6L:64110951..64110975 21/25 unknown
chr6L:79530634..79530658 21/25 unknown
chr6S:117350296..117350320 21/25 unknown
chr9_10S:42483283..42483307 21/25 unknown
tropicalis 10.0 Chr3:98670492..98670516 24/25 Antisense target bmp7.2
Chr5:119548654..119548678 21/25 Antisense off-target gucy1b2
Chr5:25362274..25362298 21/25 Sense off-target LOC105947449
Chr1:93976666..93976690 21/25 Antisense off-target fsd1
Chr2:125439883..125439907 21/25 unknown
Chr6:99458152..99458176 21/25 unknown
Publications
First: Twisted gastrulation loss-of-function analyses support its role as a BMP inhibitor during early Xenopus embryogenesis., Development 2003                
Most recent:
View All Papers