Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249205

Morpholino Name: bmp7.2 MO3
Synonyms: BMP7 MO
mRNA Target: bmp7.2

Morpholino Type: uncategorized morpholino
Sequence:
5' TTACTATCAAAGCATTCATTTTGTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 24/25 25/25
genomic

MO
5' GACAAAATGAATGCTTTGATAGTAA 3' ||||||||||||||||||||||||| 3' CTGTTTTACTTACGAAACTATCATT 5' 5' GACAAAATGAATGCTTTGACAGTAA 3' ||||||||||||||||||| ||||| 3' CTGTTTTACTTACGAAACTATCATT 5' 5' GACAAAATGAATGCTTTGATAGTAA 3' ||||||||||||||||||||||||| 3' CTGTTTTACTTACGAAACTATCATT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3S:54023955..54023979 25/25 Antisense target bmp7.2.S
chr3L:88664517..88664541 24/25 Antisense target bmp7.2.L
chr9_10S:66045022..66045046 21/25 Sense off-target LOC108702278 [provisional:col6a3]
Scaffold75:311836..311860 22/25 unknown
chr4L:68938337..68938361 21/25 unknown
tropicalis 10.0 Chr3:98670489..98670513 25/25 Antisense target bmp7.2
Chr6:108639386..108639410 21/25 Sense off-target mib1
Chr8:108094649..108094673 21/25 Antisense off-target znf106
Chr1:209685133..209685157 21/25 unknown
Chr5:56091494..56091518 21/25 unknown
Chr9:78668715..78668739 21/25 unknown
Publications
First: Twisted gastrulation is required for forebrain specification and cooperates with Chordin to inhibit BMP signaling during X. tropicalis gastrulation., Dev Biol 2006                                    
Most recent:
View All Papers