Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249220

Morpholino Name: c11orf30 MO1
Synonyms: XtEMSY MO1
mRNA Target: emsy

Morpholino Type:
Sequence:
5' CCACACCACCGGCATCCTGGCCTCT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' AGAGGCCAGGATGCCGGTGGTGTGG 3' ||||||||||||||||||||||||| 3' TCTCCGGTCCTACGGCCACCACACC 5'
Genomic Alignments Position Identity Strand Target mRNA
tropicalis 7.1 scaffold_2:139778235-139778259 25/25 Antisense target emsy
scaffold_6:28677924-28677948 22/25 unknown
Publications
First: Loss of Xenopus tropicalis EMSY causes impairment of gastrulation and upregulation of p53. [N Biotechnol 2011]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556